Identifikasi dan karakterisasi Aspergillus flavus dan aflatoksin

Identifikasi dan karakterisasi Aspergillus flavus dan aflatoksin

P. Rodrigues, C. Soares, Z. Kozakiewicz, R.R.M. Paterson1, N. Lima, and A.Venâncio
IBB-Lembaga Bioteknologi dan Bioengineering, Pusat Rekayasa Biologi, Universitas do Minho, Campus de Gualtar, 4710-057 Braga, Portugal
Cimo-Escola Superior de Bragança Agraria, Kampus de Santa Apolonia, 5301-855 Bragança, Portugal

Aspergillus flavus adalah produsen utama dari karsinogenik aflatoksin yang terkenal. Kehadiran jamur dan aflatoksin memberikan perhatian besar dalam hal keamanan makanan. Identifikasi A. flavus tidak langsung, karena kesamaan dengan spesies lain yang sangat terkait (misalnya A. parasiticus dan A. nomius). Juga, dari sudut pandang biokimia beberapa spesies yang berhubungan erat mampu menghasilkan mikotoksin yang berbeda. Untuk memperjelas perbedaan antara spesies maka diadakan diidentifikasi ulang dalam bentuk skema. Media selektif, data dari produksi mikotoksin dan alat-alat biologi molekuler dibahas dalam rangka untuk mengklarifikasi spesies A. flavus .

1. Pendahuluan
Aspergillus adalah genus besar yang terdiri dari lebih dari 180 spesies dan diterima secara anamorphik (perubahan bentuk evolusi secara bertahap), dengan teleomorphs dijelaskan dalam sembilan genus yang berbeda. Genus ini dibagi dalam 7 subgenus, yang pada selanjutnya dibagi menjadi beberapa bagian.
Seperti jamur pada umumnya, taksonomi Aspergillus adalah sangat kompleks dan terus berkembang. Genus ini mudah diidentifikasi berdasarkan karakteristik konidifor, tetapi spesies ini diidentifikasi dan diferensiasi secara kompleks, secara tradisional didasarkan pada susunan bentuk morfologinya. Bentuk-bentuk makromorphologikal meliputi konidia, warna miselium, diameter koloni, warna sejumlah koloni, produksi eksudat dan pigmen larut, kehadiran sklerotia (pengerasan pada jaringan) dan kleistothecia.
Karakterisasi mikromorpologi terutama tergantung pada seriation, bentuk dan ukuran vesikula, konidia dan stipe morfologi, kehadiran sel Hülle, dan morfologi kleistotesia dan askospora. Selanjutnya, semua fitur morfologi harus ditentukan dalam kondisi laboratorium standar oleh ahli mikologi terlatih, untuk mendapatkan identifikasi akurat. Beberapa kunci Taksonomi dan Aspergillus tersedia pada panduan.
Aspergillus subgenus circumdati bagian flavi juga disebut sebagai kelompok Aspergillus flavus, telah menarik perhatian seluruh dunia untuk keperluan industri dan potensi toksigenik. Bagian flavi dibagi dalam dua kelompok spesies. Satu termasuk jenis A. flavus aflatoksiigenik, A. parasiticus dan A. nomius, yang menyebabkan masalah serius di seluruh dunia dalam komoditas pertanian, dan yang lainnya termasuk onaflatoksigenik spesies A. oryzae, A. sojae dan A. tamarii, secara tradisional digunakan untuk produksi fermentasi makanan di Asia. Penelitian ini difokuskan pada kelompok pertama.

2. Studi Morfologi A. flavus , A. parasiticus dan A. nomius
Sekelompok penting dari jamur bawaan makanan menghasilkan aflatoksin yaitu: A. flavus, A. parasiticus dan banyak lagi baru-baru ini A. nomius. Isolat ini digunakan dalam semua pusat sumber daya utama dunia biologis, yang digunakan secara ekstensif untuk referensi dan sebagai isolat diverifikasi untuk mikotoksin dan penelitian lainnya. Kebenaran nama-nama spesies isolat yang berhubungan dengan koleksi tersebut jarang dipertanyakan.
Telah dilakukan sebuah studi morfologi rinci tentang jenis-jenis sebelumnya dan isolat lainnya yaitu A. flavus dan A. parasiticus. Aspergillus parasiticus speare awalnya terisolasi dari bahan tebu di Hawaii kemudian sesudah itu ditemukan di subkultur di seluruh dunia. Studi mengenai cahaya dan mikroskop scan elektron mengemukakan masih ada isolat konidia dari dua ornamen yg berbeda tetapi tidak ditemukan, tetapi tidak pernah ditemukan campuran antara keduanya. Saat ini morphs digunakan untuk mengenali dikotom yang diturunkan.
Salah satu bentuk isolat berasal dari jenis A. parasiticus (Gambar 1a) dan yang lainnya telah ditemukan pada A. flavus (Gambar 1b). Maka dari itu biakan untuk jenis A. Parasiticus dipegang di tiga koleksi utama di dunia yang dalam kenyataannya adalah A. flavus. Lebih mengkhawatirkan lagi, karena publikasi Kozakiewicz tidak lain koleksi di CABI, Egham, Inggris (sebelumnya IMI) yang telah kembali mancairkan partikel isolat, telah mengkonfirmasi bahwa kesalahan-kesalahan ini telah diperbaiki; menyiratkan bahwa penamaan yang salah pada materi yang terus dijual dan didistribusikan. Selanjutnya, dalam pemeriksaan rutin koleksi IMI, sepuluh tambahan isolat telah diidentifikasi ulang sampai saat ini.


a b c

Gambar. 1 Scanning elektron Micoroscopy gambar (a) parasiticus A. dan (b) spora A. flavus, dan (c) A. parasiticus kepala konidia, dimana perbedaan ornamen spora terlihat jelas,

Situasi ini semakin rumit oleh adanya Aspergillus spesies nomius. Secara morfologi, menyerupai A. flavus tetapi berbeda dengan produksi sklerotia peluru yang berbentuk kecil; sedangkan A. flavus lebih bulat. Namun, tidak jelas apakah isolat segar A. nomius selalu memproduksi sclerotia yang khas. Dalam ketidakhadiran mereka, hanya pola isoenzim dan produksi mikotoksin memberikan teknik identifikasi. Artinya, untuk A. nomius dideteksi dengan aflatoksin B1, B2, G1, G2 (seperti halnya A.parasiticus), tetapi tanpa deteksi sikolopiazonik asam metabolit sekunder. A. flavus menghasilkan asam aflatoksin B1 dan B2 dan siklopiazonik saja.

2.1 Pemisahan A. flavus dan A. parasiticus
Diagnosis sementara dari dua spesies didasarkan pada deskripsi dan kunci Raper dan Fennell. Pemisahan utama adalah keberadaan metulae dan phialides (kepala konidia biseriate) untuk A. flavus dan phialides saja (kepala konidia uniseriate) untuk A. parasiticus (Gambar 1c). Di sinilah terletak masalah. Dalam kunci untuk A. parasiticus, kata-kata "tegas uniseriate" menggantikan istilah sebelumnya "biasanya" atau "kebanyakan uniseriate"yang digunakan dalam kunci sebelumnya. Pemeriksaan sejumlah besar A. parasiticus isolat telah menunjukkan bahwa sampai dengan 10% kepala konidia dalam sebuah koloni A. parasiticus dapat memiliki metulae dan phialides (biseriate). Selain itu, tidak semua isolat A. flavus secara konsisten memproduksi metulae.
Bentuk dinding Konidia sekarang dianggap sebagai karakter diagnostik utama untuk pemisahan kedua spesies. Konidia A. flavus memiliki dinding yang relatif tipis yang halus sampai agak kasar. Bentuk mereka dapat bervariasi dari bola ke elips. Konidia A. parasiticus lebih bulat dan terasa echinulat atau spinulose. Scanning Elektron Micoroscopy (SEM) mikrograf jelas menunjukkan perbedaan-perbedaan ornamen (Gambar 1a dan 1b). Selain itu, sekali SEM mikrograf telah dipelajari dan dibandingkan, maka dengan praktek perbedaan-perbedaan ini menjadi jelas dengan menggunakan mikroskop cahaya.
Selain itu, ada beberapa media yang dipilih, yang dapat digunakan untuk membantu ahli mikologi kurang terlatih:
(i) Aspergillus diferensiasi agar (AFPA), (ii) Agar krim kelapa (CCA) dan (iii) Czapek Agar Dox (CZ). AFPA merupakan media identifikasi selektif untuk mendeteksi strain grup A. flavus. Dengan metode ini adalah mungkin untuk membedakan spesies ini dari Aspergillus lain berdasarkan pada pengembangan warna oranye di balik piring (Gambar 2a). CCA adalah digunakan untuk mendeteksi strain penghasil aflatoksin (Gambar 2b). Produksi aflatoksin terdeteksi oleh fluoresensi biru saat berhubungan dengan UV-cahaya.
Ketika ditanam di CZ, koloni taksonomi antara dua spesies juga bisa dipisahkan.
A.flavus yang kuning-hijau dan A. parasiticus yang hijau gelap, disebut sebagai dekat Ivy hijau (Gambar 3). Tabel 1 merangkum perbedaan morfologis antara dua spesies.







Tabel 1 Morfologi pemisahan A. flavus dan A. Parasiticus

Warna koloni Seriation Konidia
Bentuk tekstur
Aspergillus flavus Kuning/hijau b/u Gl/el Sm/fr
Aspergillus parasiticus Ivy green u/b Gl r

1- u = uniseriate; b = biseriate
2- gl = globose (bulat); el = elliptical (elips)
3- sm = smooth (lembut); fr = finely roughened (agak kasar); r = rough (kasar)



A b

Gambar. 2 (a) A. flavus di AFPA, setelah inkubasi 7 hari pada 25 º C, dengan warna oranye khas pada sisi belakang piring, (b) aflatoxigenic A. flavus tumbuh di piring kecil CCA bawah panjang gelombang Sinar UV, setelah 7 hari inkubasi (plat = besar diinokulasi CCA piring).



Gambar. 3 A. flavus (a) dan A. parasiticus (b) strain yang tumbuh di CZ.


3. Metode Molekuler untuk diferensiasi Bagian spesies Aspergillus flavus
Metode molekular telah banyak diterapkan dalam identifikasi sejumlah besar spesies Aspergillus. Amplifikasi DNA diikuti dengan analisis urutan DNA pada suatu alat yang canggih dalam studi taksonomi. Bahkan, Aspergillus merupakan salah satu jamur terbaik yang dipelajari secara genetik. Genom lengkap A. flavus NRRL 3357 sekarang benar-benar diurutkan dan telah dirilis ke National Center Biotechnology Information (NCBI)/ Pusat Informasi Bioteknologi Nasional pada bulan Juli 2005 dan kebanyakan urutan yang tersedia dari beberapa strain spesies kelompok A. flavus.
DNA yang digunakan untuk membedakan species Aspergillus adalah rDNA kompleks, terutama daerah internal transcribed spacer 1 dan 2 (ITS1 dan ITS2) dan variabel daerah di ujung 5 'gen rRNA 28S (D1-D2 wilayah).
Penyandian gen yang digunakan sebagai target untuk studi taksonomi dalam kelompok A. flavus, ketika segmen penyandian rDNA variabilitas kompleks. Universal β-tubulin, kalmodulin dan gen topoisomerase II telah digunakan dalam identifikasi spesies jamur dan juga pada beberapa spesies yang terkait, karena variabilitas yang umumnya rendah. Gen yang terlibat dalam metabolisme sekunder dianggap lebih bervariasi dalam beberapa spesies yang terkait. Beberapa gen yang terlibat dalam biosintesis aflatoksin telah diidentifikasi, dikloning dan dipelajari. Mereka termasuk lokus gen regulasi aflR dari A. flavus dan A. parasiticus, dan beberapa gen struktural, misalnya pksA, atau-1, ver-1, uvm8 danomtA .
Namun, Aspergillus kelompok flavus sulit untuk dibedakan secara genetik. A. flavus, A. parasiticus, A. oryzae dan A. sojae telah menunjukkan adanya keterkaitan DNA dan jenisnya serta ukuran genom. Selanjutnya, (a) A. flavus dan A. oryzae, dan (b) A. parasiticus dan A sojae., dianggap hampir mustahil untuk dibedakan, karena adanya keterkaitan DNA mereka ditemukan yang masing-masing 100% dan 91%. Tetapi, Random Amplified Polymorphic DNA (RAPD) analisis mampu untuk membedakan A. parasiticus dan A. sojae.
DNA mitokondria juga menunjukkan kontras tingkat variabilitas. Menurut Moody dkk., tidak bisa membedakan antara spesies yang sama berdasarkan studi mtDNA, meskipun menurut Wang dkk., melaporkan adanya alat yang dapat digunakan untuk membedakan jenis spesies berdasarkan urutan variabilitas sitokrom b.
Keterkaitan Genetik antara A. flavus dan A. nomius telah dipelajari, dan menunjukkan hasil yang kontras, yang berarti bahwa sejumlah besar A. nomius isolat harus diperiksa dalam rangka menentukan keterkaitan dengan spesies Aspergillus lainnya dari kelompok A. flavus .
Untuk studi dalam A. flavus, atau untuk membandingkan A. flavus dengan spesies Aspergillus lainnya, dan bahkan untuk membedakan aflatoksin produsen dari non-produsen, beberapa daerah kompleks rDNA dan struktural gen aflatoksin telah diuji untuk digunakan sebagai penanda molekuler, dengan berbagai tingkat keberhasilan. Beberapa penelitian ini didasarkan pada Polymerase Chain Reaction (PCR) amplifikasi diikuti oleh sekuensing untuk Analisis variabilitas. Tapi amplifikasi PCR daerah target DNA diketahui atau gen diikuti oleh Polimorfisme Panjang Fragmen restriksi (RFLP), konformasi Single-StrandPoli morfisme (SSCP) atau Heteroduplex Mobilitas Assay (HMA) lebih mudah diterapkan di sebagian besar laboratorium untuk studi berbagai uji sampel, dan informasi NCBI dapat digunakan untuk menghasilkan primer dan DNA probe. Kumeda dan Asao berhasil diterapkan PCR-SSCP dan PCR-RFLP untuk A. flavus membedakan dari spesies lain (termasuk A. parasiticus), berdasarkan fragmen 600 pb sesuai dengan amplifikasi daerah ITS1/5.8S/ITS2 dengan ITS4 pasangan primer ITS1-. Penulis menganggap hal ini, bahwa dengan menggunakan fragmen sebesar 600 bp, mereka bisa menghilangkan masalah utama yang diasosiasikan dengan analisis PCR-SSCP, yang merupakan variabilitas intraspesifik. Namun, analisis ini gagal pada saat membedakan antara strain yang mana, aflatoksin terdeteksi atau tidak terdeteksi. Chang dkk, menemukan gen aflR akan hampir identik dengan A. flavus dan A. parasiticus, tapi Somashekar dkk, menggunakan jumlah strain yang terbatas, mampu membedakan A. parasiticus dari A. flavus berdasarkan RFLP akibat dari mencerna sebuah fragmen aflR gen dengan enzim restriksi PvuII. Multiplex PCR, menggunakan beberapa pasang primer untuk daerah sasaran yang berbeda, yang menggunakan sebuah pendekatan alternatif untuk diferensiasi spesies, dan keberhasilannya telah diterapkan dengan menggunakan aflR, ver-1, OMT-1 dan atau-1 gen.
3.1 Metode Molekuler Untuk Diferensiasi Produsen Aflatoksin Dan Non-Produsen
Aflatoksin dapat dihasilkan, tetapi tidak terdeteksi karena batas deteksi yang melekat pada sistem analitik. Karena itu tidak mengherankan, tidak ada metode molekul yang telah dijelaskan sebelumnya yang telah dapat dengan jelas membedakan produsen aflatoksin dari non-produsen. Multiplex PCR dengan aflatoksin yang jalur gen aflR, ver-1, OMT-1 dan juga-1 tidak menghasilkan pola yang jelas.
Produksi aflatoksin dan diferensiasi strain aflatoksigenik dapat dinilai melalui pemantauan ekspresi gen aflatoksin dalam kelompok A. flavus , dengan menggunakan metode reverse transcription PCR (RT-PCR). RT-PCR memungkinkan deteksi mRNA ditranskripsi oleh gen tertentu dengan PCR amplifikasi cDNA intermediet yang disintesis oleh transkripsi terbalik. Sistem semacam ini telah berhasil diterapkan untuk memantau produksi aflatoksin dan ekspresi gen aflatoksin berdasarkan berbagai peraturan dan struktural jalur gen aflatoxin di A. Parasiticus dan/ atau A. Flavus, dan ditemukan sangat cepat dan sensitif. Scherm dkk., mempelajari 13 strain dari kedua spesies dan menemukan konsistensi dari 3 gen (aflD, aflO [syn. dmtA = omtB] dan AFLP [syn. omtA]) dalam mendeteksi kemampuan produksi aflatoksin, yang lebih lanjut menunjukkan sebagai penanda potensial.
Orang harus menyadari bahwa beberapa gen yang tidak eksklusif dari jalur biosintetik aflatoksin, Misalnya menjadi gen aflR, yang dapat membuat palsu-positif yang berasal dari sterigmatocystin yang dihasilkan oleh jamur.

3.2. Metode Molekul Keterbatasan
Bila menggunakan metode molekuler, ada beberapa hal yang harus diperhatikan. Sistem yang dipilih untuk analisis varians dalam spesies harus diuji pada subset dari taksa bunga, beberapa menggunakan isolat dari semua spesies, dan tes harus mencakup kerabat dekat dan spesies yang lebih jauh. Selain itu, internal amplifikasi kontrol (IACs) diperlukan, untuk mendeteksi hasil negatif palsu. Hal ini bisa timbul dari default reagen PCR, perputaran mesin termal inkonsistensi dan kehadiran inhibitor dari biakan atau substrat. Pada bagian terakhir ini sangat penting ketika mempelajari jamur toksigenik, karena metabolit sekunder adalah inhibitor kuat dari reaksi PCR, pada studi sampel makanan, karena komponen makanan penghambat. Ketika DNA mengkontaminasi dianggap hadir (terutama dalam makanan dan sampel lingkungan), nested PCR harus diuji dengan menggunakan dua set primer dengan berbagai tingkat kekhususan untuk menghilangkan gangguan kontaminasi.
3.3. Metode untuk Membedakan A. flavus dari A. parasiticus dan Produsen Aflatoksin dari Non-produsen
3.3.1. 1 PCR berbasis teknik
Pertumbuhan kondisi
Untuk ekstraksi DNA skala besar (kontrol strain dan optimasi protokol), sebuah loop penuh spora dari biakan selama 7 hari ditanam di Malt Extract Agar (MEA: Mat 20 g L-1, Glukosa 20 g L-1, Peptone 1 g L-1, Agar 20 g L-1) dimasukkan ke dalam labu 500 mL yang berisi 200 ml kaldu Ekstrak Malt (ME: MEA w / o agar-agar), dan diinkubasi pada 25 º C pada rotary shaker (100 rpm) selama 72 jam. Miselium dipanen oleh filtrasi melalui filter Whatman # 2 kertas, dibilas dengan larutan NaCl 0,85% dan disentrifugasi. Miselium disimpan dalam 1 g (berat segar) Aliquot di -80 º C sampai digunakan lebih lanjut.
Untuk ekstraksi DNA skala kecil (strain test), prosedur yang sama diikuti dalam tabung 1,5 mL dengan 500 uL ME. Miselium dikumpulkan oleh sentrifugasi, dicuci dua kali dengan larutan NaCl 0,85% dan disimpan pada -80 º C sampai digunakan lebih lanjut.
Ekstraksi DNA
Ekstraksi DNA skala besar adalah sebagai berikut: sebuah alikuot 1 g (berat basah) dari miselium ditempatkan pada mortar yang sebelumnya telah didinginkan pada -80 º C untuk dijadikan sebagai bubuk halus. Serbuk ditempatkan dalam 1,5 mL larutan buffer (200 mM Tris-HCl pH 8,5; 250 mM NaCl, 25 mM EDTA, 0,5% [w / v] SDS) dan dipanaskan pada 68 º C selama 15 menit, dengan pencampuran lembut sesekali. Setelah sentrifugasi 13 000 rpm selama 15 menit (4 º C), supernatan tersebut dipindahkan ke tabung baru dan polisakarida dan protein yang diendapkan dengan menambahkan 750 uL dingin 4 M natrium asetat, pada pH 5,2. Cairan yang lembut ini dicampur dengan inversi, ditempatkan di -20 º C selama 20 menit dan disentrifugasi pada 13 000 rpm selama 15 menit (4 º C). Supernatant bersih dipindahkan ke tabung baru dan diendapkan dengan satu volume isopropanol dingin (-20 º C). Cairan ini dicampur dengan inversi selama beberapa menit, diinkubasi pada -20 º C selama minimal 10 menit dan disentrifugasi pada 13 000 rpm selama 15 menit (4 º C). DNA pelet dicuci dengan 1,0 mL etanol 70% dingin, disentrifugasi pada 13 000 rpm selama 10 menit (4 º C) dan udara kering. DNA resuspended di 100 sampai 200 uL TE buffer (10 mM Tris-HCl, 1,0 mM EDTA, pH 8.0), tergantung pada hasil, dan disimpan pada -20 º C. Untuk skala kecil Ekstraksi DNA, DNeasy Pabrik Mini Kit (Qiagen, Valencia, CA, USA) digunakan sesuai dengan instruksi pabrikan.
Amplifikasi PCR
Amplifikasi PCR dilakukan pada 50 uL dari campuran reaksi reaksi yang mengandung MgCl2 buffer bebas, 3 mM MgCl2, 2,5 U Taq polimerase, 200 pM dari setiap dNTP, 0,25 pM setiap primer dan template DNA (10 ng untuk urutan multi-copy, 100 ng untuk sekuens tunggal-copy). PCR dilakukan sebagai berikut: 1) 1 langkah pada 94 º C selama 3 menit, 2) 35 siklus meliputi tiga tahap berikut: 1 menit 94 º C, 1 menit pada suhu anil (spesifik untuk masing-masing pasangan primer, biasanya pada atau dekat dengan 55 º C), 1 menit 72 º C, dan 3) satu langkah akhir 10 menit di 72 º C. Produk PCR dipisahkan dengan elektroforesis pada 1,5% agarosa gel dengan ethidium bromida 0,5% pada tahun 1x TAE buffer (40 mM Tris base, 40 mM asam asetat, 1.0 mM EDTA, pH 8,0) dan divisualisasikan di bawah sinar UV. Untuk multiplex-PCR, suhu annealing adalah dioptimalkan tergantung pada primer.
Target daerah dan primer PCR
Fragmen dari ITS1/5.8S / ITS4 kawasan target universal, serta beberapa single-copy gen, yang diamplifikasi dengan pasangan primer spesifik. Fragmen yang dihasilkan digunakan untuk analisis RFLP (PCR-RFLP). Pendekatan ini bertujuan memilih penanda molekuler yang kuat untuk membedakan spesies Aspergillus flavus.
Untuk diferensiasi aflatoksin-produsen dan non-produsen, multiplex-PCR diuji dengan beberapa gen yang terkait dengan jalur aflatoksin biosintetik. Sebuah fragmen 1500 pb(pasangan basa) dari rRNA 28S wilayah (primer pasangan D2R [5 'TTG GTC CGT GTT TCA AGA CG 3']-D7R [5 'TTG GAG ACC TGC TGC GG 3 ']) atau 900 bp fragmen yang sesuai untuk wilayah ITS2-LSU (primer pasangan CS3 [5' CGA ATC TTT GAA LKP ACA TTG 3 -] '] LR3 [5' CCG ACG AAG TGT TTC GG 3 ') dapat digunakan sebagai IAC. IAC akan dipilih tergantung pada ukuran fragmen yang diperoleh pasangan primer pengujian amplifikasi.
Analisis RFLP
Pendekatan ini bertujuan memilih penanda molekuler yang solid untuk digunakan sebagai alat cepat untuk membedakan spesies A. flavus. Produk PCR yang disampaikan ke pencernaan dengan berbagai enzim restriksi, yaitu dipilih berdasarkan urutan nukleotida isolat A. flavus beragam, termasuk yang disimpan pada Gen Bank.

3.3.2. Analisis Ekspresi Gen
Pertumbuhan kondisi
Untuk percobaan induksi aflatoksin, masing-masing strain Aspergillus tumbuh di aflatoksin-menginduksi menengah YA (ekstrak -ragi -sukrosa: 2% ekstrak ragi, sukrosa 15%) dan non-inducing medium YEP (extract-ragi-peptone: 2 ragi% ekstrak, pepton 15%).
RNA total ekstraksi
Total RNA diekstraksi dengan RNeasy Tanaman Mini Kit (Qiagen, Valencia, CA, USA), menurut instruksi pabrikan.
Reverse transcriptase PCR
RT-PCR dapat mengikuti protokol yang dijelaskan oleh Scherm dkk[35]: Reverse transkripsi dilakukan menggunakan kit Qiagen OmniscriptR (Qiagen, Valencia, CA, USA) dengan 20 campuran reaksi uL mengandung: 1x reaksi buffer, 0,5 mM setiap dNTP, 1 pM oligo dT primer, 10 U RNase inhibitor, 4 U Omniscript Reverse Transcriptase, dan 100 RNA ng. Campuran Reaksi secara singkat vortexed dan diinkubasi selama 60 menit pada 37 º C. Sampel yang tidak aktif dengan memanaskan sampai 93 º C selama 5 menit diikuti dengan pendinginan cepat di atas es. RT-PCR dilakukan dalam volume 25 uL mengandung: buffer reaksi 1x, 200 pM setiap dNTP, 0,2 AM primer masing-masing, 1 U polimerase TaqR Red, dan 1 uL dari campuran cDNA.
Perputaran Parameter meliputi: 5 menit pada 94 º C; 30 s di 94 º C, 60 s di 55 º C dan 90 s di 72 º C selama 35 siklus; dan perpanjangan terakhir pada 72 º C selama 7 menit. Untuk memeriksa keberadaan kontaminasi DNA genom di total RNA sampel, PCR dilakukan seperti dijelaskan di atas, dengan menggunakan set yang sama primer dirancang untuk RT-PCR dan 100 ng RNA total sebagai template.

RT-PCR primer
Gen rumah tangga tub1 coding β-tubulin dapat dipilih sebagai kontrol sistem untuk reversetranskripsi. 3 gen aflD, aflO dan AFLP diindikasikan oleh Scherm dkk, yang kemudian diuji sebagai penanda untuk membedakan antara produsen aflatoksin dan non-produsen (Tabel 2).
Tabel 2 Rincian gen target, urutan primer, suhu annealing dan panjang produk dasar pasangan (pb) untuk PCR dan analisis RT-PCR (diadaptasi)
Primer pair gen Primers sequences
(5´��3’) Optimal
Annealing
Temp. (ºC) PCR
product
legth (bp) RT-PCR
product size
(bp)
Tub1-F
Tub1-R tub1 GCTTTCTGGCAAACCATCTC
GGTCGTTCATGTTGCTCTCA 55 1498 1198
Nor1-F
Nor1-R aflD ACGGATCACTTAGCCAGCAC
CTACCAGGGGAGTTGAGATCC 55 990 812
OmtB(F)-F
OmtB(F)-R aflO GCCTTGACATGGAAACCATC
CCAAGATGGCCTGCTCTTTA 55 1333 1131
Omt1-F
Omt1-R aflP GCCTTGCAAACACACTTTCA
AGTTGTTGAACGCCCCAGT 55 1490 1210

4. Kesimpulan
Identifikasi A. flavus bukanlah tugas yang mudah, karena kesamaan dengan nomius A. dan A.parasiticus. Seperti ditunjukkan, dengan mengkombinasikan metode yang berbeda (pendekatan poliphasic), adalah hal ini memungkinkan untuk mencapai identifikasi yang dapat diandalkan dalam diskriminasi produsen aflatoksin putatif.
Ucapan Terima Kasih Dukungan dari P. Rodrigues dan RRM Paterson (hibah SFRH/BD/28332/2006 dan SFRH/BPD/34879/2007, masing-masing) oleh sebuah paragraf Fundacao Ciência ea Tecnologia (FCT-Portugal) rasa syukur diakui.
Referensi
J.I. Pitt, R.A. Samson and J.C. Frisvad, in: Integration of Modern Taxonomic Methods for Penicillium and Aspergillus Classification (R.A. Samson and J.I. Pitt, Eds.), Hardwood Academic Publishers, Reading, UK, 9-50 (2000).

J.I. Pitt and R.A. Samson, in: Integration of Modern Taxonomic Methods for Penicillium and Aspergillus

Classification (R.A. Samson and J.I. Pitt, Eds.), Hardwood Academic Publishers, Reading, UK, 51-72 (2000).

M.A. Klich, Indentification of common Aspergillus species, CBS, Netherlands (2002).
T. Okuda, M.A. Klich, K.A. Seifert and K. Ando, in: Integration of Modern Taxonomic Methods for Penicillium and Aspergillus Classification (R.A. Samson and J.I. Pitt, Eds.), Hardwood Academic Publishers,
Reading, UK, 83-100 (2000).

K.B. Raper and D.I. Fennell, The genus Aspergillus. Williams & Wilkins, Baltimore (1965).

Y. Kumeda and T. Asao, Applied and Environmental Microbiology 67, 4084 (2001).

Z. Kozakiewicz, Mycotaxon 15, 293 (1982).

A.T. Speare, Bulletin Hawaiian Sugar Planters Association Experimental Station, Pathological and
Physiological Series 12, 1 (1912).

Z. Kozakiewicz, in: The Genus Aspergillus from Taxonomy and Genetics to Industrial Applications, Edited by K.A. Powell, A. Renwick and J. Peberdy, FEMS Symposium No. 69, Plenum Press, New York, 303 (1994).

C.P. Kurtzman, B.W. Horn and C.W. Hesseltine, Antonie Van Leeuwenhoek 53, 147 (1987).

C. Thom and M.B. Church, The Aspergilli, Waverley Press, Baltimore (1926).

C. Thom and K.B. Raper, Manual of the Aspergilli, Williams and Wilkins, Baltimore (1945).

Z. Kozakiewicz, in: Fungal Identification Techniques, Proceedings from the Workshop in Barcelona, Spain, 5to 8 April, EUR 16510, 183 (1995).

M.A. Klich and J.I. Pitt, A laboratory guide to common Aspergillus species and their teleomorphs. North Ryde: Commonwealth Scientific and Industrial Research Organization (CSIRO) (1988).

J.I. Pitt, A.D. Hocking, D.R. Glenn, The Journal of Applied Bacteriology 54, 109 (1983).

N.D. Davis, S.K. Iver and U.L. Diener, Improved Method of Screening for Aflatoxin with a Coconut Agar
Medium, Applied and Environmental Microbiology 53, 1593 (1987).

H.P. Hinrikson, S.F. Hurst, L. de Aguirre and C.J. Morrison, Medical Mycology Supplement 1 43, S129
(2005).

H.P. Hinrikson, S.F. Hurst, T.J. Lott, D.W. Warnock and C.J. Morrison, Journal of Medical Microbiology 43,
2092 (2005).

Y. Kumeda and T. Asao, Applied and Environmental Microbiology 62, 2947 (1996).

C. Ferrer, F. Colom, S. Frasés, E. Mulet, J.L. Abad and J.L. Alió, Journal of Clinical Microbiology 39, 2873
(2001).
T. Kanbe, K. Yamaki and A. Kikuchi, Microbiology and Immunology 46, 841 (2002).

D.M. Geiser, F.M. Harbinski and J.W. Taylor, in: Integration of Modern Taxonomic Methods for Penicillium and Aspergillus Classification (R.A. Samson and J.I. Pitt, Eds.), Hardwood Academic Publishers, Reading,
UK, 381 (2000).

J. Yu, P.-K. Chang, J.W. Cary, M. Wright, D. Bhatnagar, T.E. Cleveland, G.A. Payne and J.E. Linz, Applied
and Environmental Microbiology 61, 2365 (1995).

D. Bhatnagar, J.W. Cary, K. Erlich, J. Yu and T.E. Cleveland, Mycopathologia 162, 155 (2006).

C.P. Kutzman, M.J. Smiley, C.J. Robnett and D.T. Wicklow, Mycologia 78, 955 (1986).

G.-F. Yuan, C.S. Liu and C.-C. Chen, Applied and Environmental Microbiology 61, 2384 (1995).

S.F. Moody and B.M. Tyler, Applied and Environmental Microbiology 56, 2441 (1990).

L. Wang, K. Yokoyama, H. Takahasi, N. Kase, Y. Hanya, K. Yashiro, M. Miyaji and K. Nishimura,
International Journal of Food Microbiology 71, 75 (2001).

R. Shapira, N. Paster, O. Eyal, M. Menasherov, A. Mett and R. Salomon, Applied and Environmental
Microbiology 62, 3270 (1996)

D. Somachekar, E.R. Rati and A. Chandrashekar, International Journal of Food Microbiology 93, 101 (2004).

P.-K. Chang, D. Bhatnagar, T.E. Cleveland and J.W. Bennett, Applied and Environmental Microbiology 61,
40 (1995).

G. Criseo, A. Bagnara and G. Bisignano, Letters in Applied Microbiology 33, 291 (2001).

M.J. Sweeney, P. Pàmies and A.D. Dobson, International Journal of Food Microbiology 56, 97 (2000).

Z. Mayer, P. Färber and R. Geisen, Applied and Environmental Microbiology 69, 1154 (2003).

B. Scherm, M. Palomba, D. Serra, A. Marcello and Q. Migheli, International Journal of Food Microbiology
98, 201 (2005).

R.R.M. Paterson, Process Biochemistry 41, 1467 (2006).

R.R.M. Paterson, Journal of Applied Microbiology 102, 1 (2007).

I.G. Wilson, Applied and Environmental Microbiology 63, 3741 (1997).

No comments